Divertisment

CELE MAI NEBUNEȘTI FARSE! || Farse amuzante și trucuri grozave, marca 123 GO!

ABONEAZĂ-TE: bit-ly.ru/21TgEx
Care e cea mai tare farsă pe care i-ai făcut-o vreodată cuiva? Spune-ne în comentarii!
Și nu uita să le arăți acest clip prietenilor tăi și să te abonezi la canalul nostru pentru și mai multe clipuri grozave, ca acesta!
#123GO #farse #amuzant

Muzică realizată de Epidemic Sound: www.epidemicsound.com/
Colecția de materiale: www.depositphotos.com
www.shutterstock.com

Acest videoclip este realizat în scopuri de divertisment. Nu oferim nicio garanție în ceea ce privește caracterul complet, siguranța și fiabilitatea celor prezentate. Vă asumați riscul pentru orice acțiune pe care o întreprindeți pe baza informațiilor din acest videoclip, iar noi nu vom fi răspunzători pentru eventualele daune sau pierderi aferente. Este responsabilitatea privitorului să-și folosească buna judecată, să fie prudent și să-și ia măsurile de precauție necesare dacă intenționează să reproducă cele prezentate în videoclip.
Acest videoclip ar putea include activități realizate de actorii noștri într-un mediu controlat - te rugăm să-ți folosești buna judecată, să fii prudent și să-ți iei toate măsurile de precauție dacă intenționezi să reproduci ceva din cele prezentate în videoclip.

Comentarii 

  1. Chirac Daniela

    Chirac Daniela

    Acum o Zi

    Eu mam îmbrăcat în haine de politie

  2. Stefan Ionica

    Stefan Ionica

    Acum 4 Zile

    Dansuri jdk LA MULȚI texte iubihsa sf KJkckdkdkdkdkdkfkckcjcndkskzdkdzkxnjckcxkxmzmznxnxnxmzmzmzznzmzmxmxnnxnxmxxmxnxnzkaozospwpdozosoaoakmxMsmsnsannwnwmwmwmwmwnsdndncmdmsmaamasmdmdlle LA utilizatori wrigt dj Z zz LA MULȚI texte nxndfnfje

  3. Adriana Ancuta

    Adriana Ancuta

    Acum 7 Zile

    Prima mea farsă a fost cu o cutie care stătea deasupra uși

  4. Ana Ittu

    Ana Ittu

    Acum 11 Zile

    Vreau să faceci canal de jocuri pe calculator și telefon

  5. cristea marian

    cristea marian

    Acum 11 Zile

    Te uresc Sofia 🤬🤬🤬🤬😡😡😡😡😠😠😠👿👿👿👿

  6. Simona Ekena Cocos

    Simona Ekena Cocos

    Acum 11 Zile

    Nesitita. Tu. Ai. Mcat. Hodocul😾😾😾😾😾😾😾😾😾😾😾😾😾😾😾😾😾😾😾😔

  7. Raducan Ionut

    Raducan Ionut

    Acum 17 Zile

    MIE ÎMI PLACE FARSA AIA CU CASTRAVETI 😂😂

  8. Miu Maria

    Miu Maria

    Acum 21 o Zi

    Nu Kevin e nesimțit ci tu Sofia

  9. Anna Barba

    Anna Barba

    Acum 28 Zile

    Pppppppppppppppppppppppppppp} pppp} m. Pmp. Mp. Mmmmmmmp. Mmp.. Ppmmmmmpmmmmmmp. Mppmpmmp. Mmmmmmmmmmmmmmmppmmmpmmm. Pmmpmmpmmpmmpmpmm. Km. Km k(

  10. Ionut Ciobanica

    Ionut Ciobanica

    Acum lună

    99ihhgr

  11. Robert Ramses

    Robert Ramses

    Acum lună

    Hscksxs

  12. Analyse Aenoaei

    Analyse Aenoaei

    Acum lună

    Mama lui kevin buna kevin ce ai pe dinti?kevin aaa nimic

    • Daria Georgiana Petcu

      Daria Georgiana Petcu

      Acum lună

      Nu esti mama lui Kevin

  13. Nuica Ionut

    Nuica Ionut

    Acum lună

    😗☺😊

  14. Nuica Ionut

    Nuica Ionut

    Acum lună

    Uifguu

  15. Alexandra Georgiana Melinte

    Alexandra Georgiana Melinte

    Acum lună

    Tv ec

  16. NICOLETA IULIA MĂRGELU

    NICOLETA IULIA MĂRGELU

    Acum lună

    🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰🥰

  17. Iubire Mae

    Iubire Mae

    Acum lună

    U

  18. Dana Mihaela

    Dana Mihaela

    Acum lună

    🤮🤮🤮🤮🤮🤮🤮🤮❤❤❤

  19. Dana Mihaela

    Dana Mihaela

    Acum lună

    A ha ha ce amuzant 🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣🤣

    • Dana Mihaela

      Dana Mihaela

      Acum lună

      Eu sunt deja abonata

  20. Dana Mihaela

    Dana Mihaela

    Acum lună

    Bona petit Sofia îţi place mâcarea😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋😋

  21. Liviu Monu

    Liviu Monu

    Acum lună

    LiVU

  22. Boros Otvos

    Boros Otvos

    Acum lună

    Pune ketchup în nas face o farsă pe Kevin să crească tai lupii nas și îți face și apoi la Lili face o farsă Goodbye Goodbye goodbye

  23. MARIO-ROBERT SMĂU

    MARIO-ROBERT SMĂU

    Acum lună

    Chevron a mâncat ardei iuți 😰😰😱😱

  24. Adrian Carausu

    Adrian Carausu

    Acum lună

    Super tare

  25. Mihaela Panaitescu

    Mihaela Panaitescu

    Acum lună

    Khhjj

  26. Simona Baidoc

    Simona Baidoc

    Acum lună

    Izjcvhv

  27. Alexandra Mihalache

    Alexandra Mihalache

    Acum lună

    Xyxududi

  28. Alexandra Cozma

    Alexandra Cozma

    Acum lună

    😄😄😃

  29. modern talking Bey Phoebe

    modern talking Bey Phoebe

    Acum lună

    3:37

  30. Dan Bors

    Dan Bors

    Acum lună

    Sunteti super!,123 go

    • Rebeca Hagiu

      Rebeca Hagiu

      Acum lună

      Hai la salon de la 2noaptea

    • Rebeca Hagiu

      Rebeca Hagiu

      Acum lună

      💋💋💋💏💏

  31. Tania Grigorescu

    Tania Grigorescu

    Acum lună

    MkjbmljuhevhahzjzmJjs

  32. Alex Clim

    Alex Clim

    Acum lună

    Am făcut și eu o farsă la bunul meu prieten și am râs și eu și a mea plăcut când am făcut o farsă chiar vă iubesc 1 2 3 go

  33. Cristina Goga

    Cristina Goga

    Acum lună

    O4oaskwjstehssyseheierieoddkfufeodirhhdfhieieuerurur

  34. Edina Ferent

    Edina Ferent

    Acum lună

    Nu stau în românia, în america

  35. Evelyn Cateloiu

    Evelyn Cateloiu

    Acum lună

    333333333rrrrrrř

  36. Elena Morosan

    Elena Morosan

    Acum lună

    Ce tare

  37. ADELIN FLORIN HODAN

    ADELIN FLORIN HODAN

    Acum lună

    Gxz

  38. Mariana Jalba

    Mariana Jalba

    Acum lună

    Cel mai tare video😍😘❤❤❤❤❤❤❤❤❤

  39. Maria Erica Ciosescu

    Maria Erica Ciosescu

    Acum lună

    Voi stați în românia?

    • Anghel Hanim

      Anghel Hanim

      Acum lună

      Nu ei traduce

    • Alexandru Dragan

      Alexandru Dragan

      Acum lună

      Ğbp

  40. Mellisa Atzeni

    Mellisa Atzeni

    Acum lună

    Și adoua

  41. Mellisa Atzeni

    Mellisa Atzeni

    Acum lună

    Prima farsa mai a fost untrun video clip

    • Vanessa Manea

      Vanessa Manea

      Acum 9 Zile

      MSC

  42. Antoneta Sonea

    Antoneta Sonea

    Acum lună

    Îmi plac. Atât de mult episoadele voastre😁😁😁😁😁😁😁

  43. Ionela Ghenea

    Ionela Ghenea

    Acum lună

    Wow ce farse,😍🥰😀😀😀😀😀😀😀

  44. Crina Girdeanu

    Crina Girdeanu

    Acum lună

    🤠🤠🤠

  45. Larisa Larisa

    Larisa Larisa

    Acum lună

    Ce fain

  46. Alina Viorica Zainescu

    Alina Viorica Zainescu

    Acum lună

    Tare

    • qDead

      qDead

      Acum 11 ore

      Ajpis

  47. Meluta Suru

    Meluta Suru

    Acum lună

    Sofia ești furăcioasă de mâncare

    • Cristi Paveliuc

      Cristi Paveliuc

      Acum 12 Zile

      👩‍🏫🏤🏤🏤👩‍🎓🧘🛌🛌🛌🛌🥰🏴‍☠️🏴‍☠️🏴‍☠️🇦🇴🏴‍☠️🏴‍☠️🏴‍☠️🏴‍☠️🏴‍☠️🏴‍☠️🏴‍☠️🏴‍☠️

    • Cristi Paveliuc

      Cristi Paveliuc

      Acum 12 Zile

      🛀🛀🛀🛀🛀🛀🛀🛀

    • Cristi Paveliuc

      Cristi Paveliuc

      Acum 12 Zile

      🕵️🕵️🕵️🕵️🕵️🕵️🧖

  48. Ilinca Belibov

    Ilinca Belibov

    Acum lună

    Sunteţi grozavi

  49. Gabriel Leurzeanu

    Gabriel Leurzeanu

    Acum lună

    Etg

  50. Alina Varga

    Alina Varga

    Acum lună

    wiiejrojtojekjeifjtojgprrjrurjs356gvkvxfhfghdjhejdjsbeiwondkxufùdjdùùoùùjdjjwklwjlgm jkri8i3o8i48tt8paovkmncopPr0kdokepmfigiu1orktkrkleif

  51. Alina Varga

    Alina Varga

    Acum lună

  52. Viorel Cociu

    Viorel Cociu

    Acum lună

    poti te rog sa faci VIDOCLIPURI cu îmbrăcăminte??plss

    • Meluta Suru

      Meluta Suru

      Acum lună

      @Mioara Rosioru ce ehh o să facă

    • Mioara Rosioru

      Mioara Rosioru

      Acum lună

      @Meluta Suru eeh

    • Meluta Suru

      Meluta Suru

      Acum lună

      o sa facă

  53. io boros

    io boros

    Acum lună

    157

  54. razvan bulboaca

    razvan bulboaca

    Acum lună

    noCiv

  55. Ana MaraMax

    Ana MaraMax

    Acum lună

    hahaha nu nu nu

  56. Laura Muresan

    Laura Muresan

    Acum lună

    Îmi plac atât de mult episoadele voastre😍

  57. hhh hhh

    hhh hhh

    Acum lună

    Mamei mele iam pus un ou fals în cutia cu o

  58. Valerica Bănică

    Valerica Bănică

    Acum lună

    😱😱😱🥰🥰🥰💙💙💙💋💋💋🍬👍

  59. Mihalache AnaMaria

    Mihalache AnaMaria

    Acum lună

    Este un videoclip foarte amuzant ☺️☺️☺️☺️☺️sunteți foarte tari

    • Et C

      Et C

      Acum 8 Zile

      Ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga ga'def'def'def'def'def'def

  60. Nicoleta Dulgheriu

    Nicoleta Dulgheriu

    Acum lună

    Va ador

  61. Gul Mustafa

    Gul Mustafa

    Acum lună

    Ddwk123go😘😘😘😘😘😘😘😘😘😘😘😘

  62. Sergiu Gutsu

    Sergiu Gutsu

    Acum lună

    👍🏻Aobonare si🔔

  63. Troaca Bombardieru

    Troaca Bombardieru

    Acum lună

    sqj jcbvvdivdjc bc

  64. Marian david

    Marian david

    Acum lună

    Nu eate adv este americani si lea luat de la ei nu este romani daca era romanu dadea inima

  65. Troaca Bombardieru

    Troaca Bombardieru

    Acum lună

    😆😆😆😆😆😆😆😆😆😆😆

  66. Roman Florina

    Roman Florina

    Acum lună

    Kevin a mâncat ardei iute 😱😱

    • Donisei Ines

      Donisei Ines

      Acum 4 Zile

      D și a

    • SOFIA OLTEANU

      SOFIA OLTEANU

      Acum 6 Zile

      Da și ce?

    • Arcadie Sfintitchi

      Arcadie Sfintitchi

      Acum 10 Zile

      Yfgrrggi3ihiejh3jrjhhrjjj

    • Andreea Adelina756

      Andreea Adelina756

      Acum lună

      🦄🦄

    • Lucia theangelblack

      Lucia theangelblack

      Acum lună

      Dwa

  67. ALEXANDRA COSTINA MIRCIU

    ALEXANDRA COSTINA MIRCIU

    Acum lună

    Căutămă pe Instagram Costina 754

  68. Patricia Vlad

    Patricia Vlad

    Acum lună

    123 go

    • CONSTANTIN IOAN NEGREA

      CONSTANTIN IOAN NEGREA

      Acum lună

      Îi jjtqbuwqccc

    • CONSTANTIN IOAN NEGREA

      CONSTANTIN IOAN NEGREA

      Acum lună

      Stomatologie rldaBDJKN

  69. Andreea Gavrilaș

    Andreea Gavrilaș

    Acum lună

    Va ador inima pls

  70. dominic david

    dominic david

    Acum lună

    100000000000000000000000000000000000000000000000000k licuerui

  71. Dima Bianca

    Dima Bianca

    Acum lună

    if9s8sooO♡◇♧♤☆

  72. MARIANA GIADA CONDURACHE

    MARIANA GIADA CONDURACHE

    Acum lună

    ❤️❤️❤️❤️

    • amuZNT 1111 Anghel

      amuZNT 1111 Anghel

      Acum lună

      😀😀😀😀😃😃😃😄😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😃😙😃😃😃😃😃😃😃😃😙😄😄😄😃😃😃😃😃😃😃😃😃😃😃😃😃😃😄😃😄😄😃

  73. Cosmin Condei

    Cosmin Condei

    Acum lună

    Bravk

  74. Sava Claudia Ana

    Sava Claudia Ana

    Acum lună

    Sa mai faceti videouri mereu pentru CA sunteti tari

  75. Florian Florin

    Florian Florin

    Acum lună

    123x

  76. sercan regep jr

    sercan regep jr

    Acum lună

    Vouă care vă place " lumea la la" sau "123 go "

    • sercan regep jr

      sercan regep jr

      Acum lună

      @Patricia Vlad să aveți sănătate fete și băieți dați laik ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️

    • Patricia Vlad

      Patricia Vlad

      Acum lună

      123 go

    • sercan regep jr

      sercan regep jr

      Acum lună

      Lumea la la vs 123 go

    • Stefania Paraschiv

      Stefania Paraschiv

      Acum lună

      LUMEA LA LA

  77. Cristian Stanciu

    Cristian Stanciu

    Acum lună

    Super tare

  78. Daniela Raluka

    Daniela Raluka

    Acum lună

    🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🇦🇩🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈🏳️‍🌈💜💜💜💜💜💜💜💜💜💜💜💜💚💚💚💚💚💚💚💚💚💚💚💚💛💛💛💛💛💛💛💛💛💛💛💛👞👞👞👞👞👞👞👞👞👞👞👞👕👕👕👕👕👕👕👕👕👕👕👕👖👖👖👖👖👖👖👖👖👖👖👖🕶🕶🕶🕶🕶🕶🕶🕶🕶🕶🕶🕶👔👔👔👔👔👔👔👔👔👔👔👔💍💍💍💍💍💍💍💍💍💍💍💍👛👛👛👛👛👛👛👛👛👛👛👛👜👜👜👜👜👜👜👜👜👜👜👜💄💄💄💄💄💄💄💄💄💄💄💄🍎🍎🍎🍎🍎🍎🍎🍎🍎🍎🍎🍎🍫🍫🍫🍫🍫🍫🍫🍫🍫🍫🍫🍫👒👒👒👒👒👒👒👒👒👒👒👒👗👗👗👗👗👗👗👗👗👗👗👗👑👑👑👑👑👑👑👑👑👑👑👑👠👠👠👠👠👠👠👠👠👠👠👠

  79. Sofia Ticu

    Sofia Ticu

    Acum lună

    Trebuie să ai marker comestibil pt dinți

    • Meluta Suru

      Meluta Suru

      Acum lună

      Da

    • Larisa Cuzub

      Larisa Cuzub

      Acum lună

      😂😂😂😂

  80. Daniela Raluka

    Daniela Raluka

    Acum lună

    Buna ♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️💟💟💟💟💟💟💟💟💟💟💟💟

  81. Edina Ferent

    Edina Ferent

    Acum lună

    Prima farsă

  82. Reyyan 929 Balascan

    Reyyan 929 Balascan

    Acum lună

    Dggvh

  83. Raluca-Mihaela Alexandru

    Raluca-Mihaela Alexandru

    Acum lună

    😃😃😃😃😃😃😃😃😁😁😁😁

  84. Redyty Gabriela

    Redyty Gabriela

    Acum lună

    Prima ♥️♥️♥️vă ador ♥️♥️♥️

    • Redyty Gabriela

      Redyty Gabriela

      Acum lună

      @유이코란 Eu nu mă pun cu copii Și aici se încheie discuția🤬🤬🤬

    • 유이코란

      유이코란

      Acum lună

      Și dacă nu vreau te-ai gândit la asta?

    • Redyty Gabriela

      Redyty Gabriela

      Acum lună

      @유이코란 ttttttttttaaaaaaacccccciiii

    • 유이코란

      유이코란

      Acum lună

      Nu e adevărat asta acum 3 ore.

    • 유이코란

      유이코란

      Acum lună

      Ba nu e adv

  85. Costică ciocan

    Costică ciocan

    Acum lună

    Vă ador

  86. Simona Triscaru

    Simona Triscaru

    Acum lună

    Bună fetelor și băieți💓💓💓💓💓

  87. Cupciac Camelia

    Cupciac Camelia

    Acum lună

    WOW😲

    • Meluta Suru

      Meluta Suru

      Acum lună

      🤦‍♀️🤦‍♀️🤦‍♀️

    • amuZNT 1111 Anghel

      amuZNT 1111 Anghel

      Acum lună

      Hrieuesujshsshhsjssjsksj😀😀😀😀😀😀😀😀

    • Meluta Suru

      Meluta Suru

      Acum lună

      Ce?

    • Anne Vasilca

      Anne Vasilca

      Acum lună

      🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔🤔

  88. •star_lover• Elena

    •star_lover• Elena

    Acum lună

    👍👍👍👍👍👍👍👍👍👍 👍 👍 👍 👍 👍 👍 👍 👍 👍 👍 👍 👍 👍

  89. ADRIANA BURUEANA

    ADRIANA BURUEANA

    Acum lună

    😘😘🥰🥰🥰 a fost foarte amuzant 😂😅😂😅♥️♥️

    • Larisa Cuzub

      Larisa Cuzub

      Acum lună

      @Stefania Paraschiv Ce tare si eu sunt bibisor. Si mai am un bff si este si ea bibisor. O cheama Cristina😄😄 a pe clasă a _lll-a

    • Larisa Cuzub

      Larisa Cuzub

      Acum lună

      @Stefania Paraschiv Esti bibisor?

    • Stefania Paraschiv

      Stefania Paraschiv

      Acum lună

      @Larisa Cuzub BINE HAI SA FIM BFF

    • Stefania Paraschiv

      Stefania Paraschiv

      Acum lună

      @Larisa Cuzub DA SUNT BIBISOR

    • Larisa Cuzub

      Larisa Cuzub

      Acum lună

      @Stefania Paraschiv Vrei sa fim bff?

  90. Iuliana Beregoi

    Iuliana Beregoi

    Acum lună

    Foarte tare!!!💯💯💯

    • Zoro Smen

      Zoro Smen

      Acum lună

      Eyujfyhfyygtiggkn

  91. Amalia Elena Rusu

    Amalia Elena Rusu

    Acum lună

    Foarte tari clipurile voastre!

  92. LAVINIA LEONIDA BALAJ

    LAVINIA LEONIDA BALAJ

    Acum lună

    Top1 🥇

    • Prozorovschi Valeri

      Prozorovschi Valeri

      Acum lună

      OLuyjgjgjguguthibihrtejvjhturvitrvhusitrhudivhuri. Iunfuinfuufrvunufhbufrhurtvjkmkgfmkfgnjgfgufdhufgdhufd⚽🎈10. 20

    • Prozorovschi Valeri

      Prozorovschi Valeri

      Acum lună

      20

  93. Rosie Cloud Horse Riding Tales

    Rosie Cloud Horse Riding Tales

    Acum lună

    Mie im Place Clipul Este Foarte Amuzant!👏👏👏❤❤❤❤😊

  94. Miriam Nemes

    Miriam Nemes

    Acum lună

    MiRiAM

  95. Iulian Iancu

    Iulian Iancu

    Acum lună

    Să faceți și farsebîn alt episod.pls.

    • Iulian Iancu

      Iulian Iancu

      Acum lună

      ** farse în**

  96. BEATRICE ANNAMARIA HANGANU

    BEATRICE ANNAMARIA HANGANU

    Acum lună

    Va ador

  97. Antonela Secal

    Antonela Secal

    Acum lună

    Cine e fan 123 go Romania like aici

  98. Flori Stan

    Flori Stan

    Acum lună

    Tare.

    • un unicorn

      un unicorn

      Acum lună

      Foarte adevărat

    • Veronica Silochi

      Veronica Silochi

      Acum lună

      Tare.

    • Florentina Ghiurea

      Florentina Ghiurea

      Acum lună

      Tare

  99. Chira Bogdan

    Chira Bogdan

    Acum lună

    Super. Tare. Va. Ador. 🥰🥰

  100. Adriana Răducanu

    Adriana Răducanu

    Acum lună

    Dhbjdh💜💎💜💎

următor